Original Articles
Study of Genetic Polymorphisms in the Tumor Necrosis Factor α Promoter Region in Spanish Patients With Psoriasis
Estudio de los polimorfismos genéticos de la región promotora del TNF-α en pacientes españoles afectos de psoriasis
Leído
7540
Vecesse ha leído el artículo
2509
Total PDF
5031
Total HTML
Compartir estadísticas
array:24 [ "pii" => "S1578219012001424" "issn" => "15782190" "doi" => "10.1016/j.adengl.2012.05.009" "estado" => "S300" "fechaPublicacion" => "2012-05-01" "aid" => "498" "copyright" => "Elsevier España, S.L. and AEDV" "copyrightAnyo" => "2011" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Actas Dermosifiliogr. 2012;103:301-7" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 3437 "formatos" => array:3 [ "EPUB" => 47 "HTML" => 2590 "PDF" => 800 ] ] "Traduccion" => array:1 [ "es" => array:19 [ "pii" => "S0001731011004637" "issn" => "00017310" "doi" => "10.1016/j.ad.2011.10.002" "estado" => "S300" "fechaPublicacion" => "2012-05-01" "aid" => "498" "copyright" => "Elsevier España, S.L. and AEDV" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Actas Dermosifiliogr. 2012;103:301-7" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 4498 "formatos" => array:3 [ "EPUB" => 2 "HTML" => 3111 "PDF" => 1385 ] ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original</span>" "titulo" => "Estudio de los polimorfismos genéticos de la región promotora del TNF-α en pacientes españoles afectos de psoriasis" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "301" "paginaFinal" => "307" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "Study of Genetic Polymorphisms in the Tumor Necrosis Factor α Promoter Region in Spanish Patients With Psoriasis" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figura 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1070 "Ancho" => 2257 "Tamanyo" => 350001 ] ] "descripcion" => array:1 [ "es" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Ejemplo de una secuencia para el polimorfismo -857 (T/C).</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "E. Gallo, T. Cabaleiro, M. Román, F. Abad-Santos, E. Daudén" "autores" => array:5 [ 0 => array:2 [ "nombre" => "E." "apellidos" => "Gallo" ] 1 => array:2 [ "nombre" => "T." "apellidos" => "Cabaleiro" ] 2 => array:2 [ "nombre" => "M." "apellidos" => "Román" ] 3 => array:2 [ "nombre" => "F." "apellidos" => "Abad-Santos" ] 4 => array:2 [ "nombre" => "E." "apellidos" => "Daudén" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S1578219012001424" "doi" => "10.1016/j.adengl.2012.05.009" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1578219012001424?idApp=UINPBA000044" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0001731011004637?idApp=UINPBA000044" "url" => "/00017310/0000010300000004/v1_201304241404/S0001731011004637/v1_201304241404/es/main.assets" ] ] "itemSiguiente" => array:19 [ "pii" => "S1578219012001497" "issn" => "15782190" "doi" => "10.1016/j.adengl.2012.05.016" "estado" => "S300" "fechaPublicacion" => "2012-05-01" "aid" => "509" "copyright" => "Elsevier España, S.L. and AEDV" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Actas Dermosifiliogr. 2012;103:308-16" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 3779 "formatos" => array:3 [ "EPUB" => 54 "HTML" => 2924 "PDF" => 801 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Article</span>" "titulo" => "The Value of Laminin-322 Staining in Distinguishing Between Keratoacanthoma, Keratoacanthoma With Areas of Squamous Cell Carcinoma, and Crateriform Squamous Cell Carcinoma" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "308" "paginaFinal" => "316" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Utilidad de la tinción con laminina-332 para diferenciar queratoacantoma, queratoacantoma con áreas de carcinoma epidermoide y carcinoma epidermoide crateriforme" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0020" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 1306 "Ancho" => 1750 "Tamanyo" => 820752 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">A and B. Keratoacanthoma with an area of incipient squamous cell carcinoma (SCC). C and D. Focal but strong staining in the region of incipient SCC. (A: Hematoxylin/eosin [H/E] x40, inset shows lower-magnification view of H/E. B. H/E x200. C. Laminin x40. D. Laminin x100.) The asterisks indicate amplified areas.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "R. Corbalán-Vélez, E. Martínez-Barba, M.J. López-Poveda, I. Vidal-Abarca Gutiérrez, J.A. Ruíz-Maciá, I. Oviedo-Ramirez, T. Martínez-Menchón" "autores" => array:7 [ 0 => array:2 [ "nombre" => "R." "apellidos" => "Corbalán-Vélez" ] 1 => array:2 [ "nombre" => "E." "apellidos" => "Martínez-Barba" ] 2 => array:2 [ "nombre" => "M.J." "apellidos" => "López-Poveda" ] 3 => array:2 [ "nombre" => "I." "apellidos" => "Vidal-Abarca Gutiérrez" ] 4 => array:2 [ "nombre" => "J.A." "apellidos" => "Ruíz-Maciá" ] 5 => array:2 [ "nombre" => "I." "apellidos" => "Oviedo-Ramirez" ] 6 => array:2 [ "nombre" => "T." "apellidos" => "Martínez-Menchón" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S0001731011004741" "doi" => "10.1016/j.ad.2011.09.004" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0001731011004741?idApp=UINPBA000044" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1578219012001497?idApp=UINPBA000044" "url" => "/15782190/0000010300000004/v1_201304241303/S1578219012001497/v1_201304241303/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S1578219012001412" "issn" => "15782190" "doi" => "10.1016/j.adengl.2012.05.008" "estado" => "S300" "fechaPublicacion" => "2012-05-01" "aid" => "484" "copyright" => "Elsevier España, S.L. and AEDV" "documento" => "article" "crossmark" => 0 "subdocumento" => "fla" "cita" => "Actas Dermosifiliogr. 2012;103:294-300" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 2889 "formatos" => array:3 [ "EPUB" => 49 "HTML" => 2194 "PDF" => 646 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Articles</span>" "titulo" => "Risk Factors for Basal Cell Carcinoma: A Study From the National Dermatology Center of Colombia" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "294" "paginaFinal" => "300" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Factores de riesgo de carcinoma basocelular. Un estudio del Centro Nacional de Dermatología de Colombia" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "G. Sánchez, J. Nova, F. de la Hoz" "autores" => array:3 [ 0 => array:2 [ "nombre" => "G." "apellidos" => "Sánchez" ] 1 => array:2 [ "nombre" => "J." "apellidos" => "Nova" ] 2 => array:2 [ "nombre" => "F." "apellidos" => "de la Hoz" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "es" => array:9 [ "pii" => "S0001731011004212" "doi" => "10.1016/j.ad.2011.07.012" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "es" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0001731011004212?idApp=UINPBA000044" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1578219012001412?idApp=UINPBA000044" "url" => "/15782190/0000010300000004/v1_201304241303/S1578219012001412/v1_201304241303/en/main.assets" ] "en" => array:20 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original Articles</span>" "titulo" => "Study of Genetic Polymorphisms in the Tumor Necrosis Factor α Promoter Region in Spanish Patients With Psoriasis" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "301" "paginaFinal" => "307" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "E. Gallo, T. Cabaleiro, M. Román, F. Abad-Santos, E. Daudén" "autores" => array:5 [ 0 => array:4 [ "nombre" => "E." "apellidos" => "Gallo" "email" => array:1 [ 0 => "egallo@aedv.es" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">¿</span>" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "T." "apellidos" => "Cabaleiro" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "M." "apellidos" => "Román" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 3 => array:3 [ "nombre" => "F." "apellidos" => "Abad-Santos" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 4 => array:3 [ "nombre" => "E." "apellidos" => "Daudén" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] ] ] ] "afiliaciones" => array:2 [ 0 => array:3 [ "entidad" => "Servicio de Dermatología, Hospital Universitario de La Princesa, Instituto Teófilo Hernando, Instituto de Investigación Sanitaria Princesa, Madrid, spain" "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Servicio de Farmacología Clínica, Hospital Universitario de La Princesa, Instituto de Investigación Sanitaria Princesa, Madrid, spain" "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Estudio de los polimorfismos genéticos de la región promotora del TNF-α en pacientes españoles afectos de psoriasis" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 950 "Ancho" => 1583 "Tamanyo" => 144996 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Example of a sequence for polymorphism -238 (A/G).</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">One of the main problems in clinical pharmacology is dealing with interindividual variability in the effects of drugs, both in terms of efficacy and safety.<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a> The same drug can be very effective in one patient but lead to adverse reactions that require discontinuation of treatment in another. This variability is due to both genetic factors, which account for 20% to 95% of the variability in the bioavailability and effect of the drug,<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a> and nongenetic factors, which unlike genetic factors can vary during an individual's lifespan. These nongenetic factors include physiological factors (age, sex, weight, and body fat), pathophysiological factors (liver, kidney, and cardiovascular function, and associated diseases), and environmental factors (tobacco and alcohol consumption and concomitant treatments).</p><p id="par0010" class="elsevierStylePara elsevierViewall">The main challenge facing medicine today is identifying the variables that can predict response to a drug or its toxicity in each individual prior to treatment. Pharmacogenetics is the study of genetic characteristics and their relationship with pharmacological response, both in terms of efficacy and adverse reactions. The first step in this process is to study individual genetic variations.</p><p id="par0015" class="elsevierStylePara elsevierViewall">In the case of psoriasis, studies have attempted to identify genetic polymorphisms that act as markers of disease susceptibility. The main genes analyzed to date are the major histocompatibility complex HLA-Cw*0602<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a> and the genes encoding tumor necrosis factor (TNF) α,<a class="elsevierStyleCrossRefs" href="#bib0020"><span class="elsevierStyleSup">4–10</span></a> various interleukins such as IL-1β, IL-6, and IL-10,<a class="elsevierStyleCrossRefs" href="#bib0055"><span class="elsevierStyleSup">11,12</span></a> subunit p40 common to IL-12 and IL-23, a subunit of the IL-23 receptor,<a class="elsevierStyleCrossRef" href="#bib0065"><span class="elsevierStyleSup">13</span></a> IL-13 and IL-15,<a class="elsevierStyleCrossRef" href="#bib0070"><span class="elsevierStyleSup">14</span></a> SNF313 (a gene implicated in protein ubiquitination),<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a> and transforming growth factor β,<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a> as well as the promoter of the gene encoding interferon-γ.<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">Of particular interest in psoriasis is the study of polymorphisms in the <span class="elsevierStyleItalic">TNF-α</span> gene, given that most biologics used to treat the disease target TNF-α protein.<a class="elsevierStyleCrossRefs" href="#bib0090"><span class="elsevierStyleSup">18–21</span></a><span class="elsevierStyleItalic">TNF-α</span> is located on the short arm of chromosome 6, very close to the major histocompatibility complex B. This region is highly polymorphic, with up to 44 polymorphisms reported,<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">22</span></a> some of which have been associated with different diseases. Polymorphisms at positions 238 and 308 of the <span class="elsevierStyleItalic">TNF-α</span> promoter have been associated in some studies with response to anti-TNF-α biologics in rheumatologic diseases such as rheumatoid arthritis and ankylosing spondilitis.<a class="elsevierStyleCrossRefs" href="#bib0110"><span class="elsevierStyleSup">22–29</span></a> Polymorphisms at position 857 have also been associated with response to other biologics in patients with rheumatoid arthritis.<a class="elsevierStyleCrossRefs" href="#bib0150"><span class="elsevierStyleSup">30,31</span></a> A study in patients with rheumatoid arthritis, published by Oregón-Romero et al.<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">32</span></a> showed that those patients with 2 wild-type alleles at both position 238 and position 308 had higher levels of <span class="elsevierStyleItalic">TNF-α</span> messenger RNA and TNF-α protein production than those with 1 mutant allele. The same differences were not found in healthy individuals, however.</p><p id="par0025" class="elsevierStylePara elsevierViewall">In psoriasis, the most widely studied polymorphisms are substitution of guanine by adenine at positions 238 and 308 (-238G→A, -308G→A), substitution of cytosine by thymine at position 857 (-857C→T), and substitution of thymine by cytosine at position 1031 (-1031T→C). The first 2 polymorphisms, located in the promoter region of the gene, have been associated with the severity of psoriasis,<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">32</span></a> whereas the presence of -857<span class="elsevierStyleHsp" style=""></span>T has been associated with a greater risk of psoriatic arthritis, but not psoriasis. However, no conclusive associations have been found for polymorphisms at position 1031.<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a></p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Objective</span><p id="par0030" class="elsevierStylePara elsevierViewall">The primary objective of this study was to investigate genetic polymorphisms in the <span class="elsevierStyleItalic">TNF-α</span> promoter in patients with psoriasis and control subjects and to establish possible allelic and genetic differences between the 2 groups.</p></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Materials and Methods</span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Study Design</span><p id="par0035" class="elsevierStylePara elsevierViewall">This was a prospective study in patients with moderate to severe plaque psoriasis, defined as a psoriasis area and severity index greater than or equal to 10 and/or an affected body surface area greater than 10%, with or without psoriatic arthritis. All patients were resident in the autonomous communities of Madrid or Castile-La Mancha, Spain. Patients did not have to be of Spanish origin to be included, although 97% of them were.</p><p id="par0040" class="elsevierStylePara elsevierViewall">For the control group, we used healthy volunteers from the clinical trials unit of the clinical pharmacology department. To be included, the healthy controls had to be residents of the autonomous community of Madrid and be nonsmokers of Spanish descent with no personal or family history of psoriasis in first-degree relatives.</p><p id="par0045" class="elsevierStylePara elsevierViewall">The study was approved by the ethics committee of our hospital. Informed consent was obtained from all healthy volunteers prior to sample collection.</p><p id="par0050" class="elsevierStylePara elsevierViewall">For this study, we selected the following most widely studied polymorphisms in patients with psoriasis: -238 G→A (rs361525), -308 G→A (rs1800629), -857 C→T (rs1799724), and -1031 T→C (rs1799964).</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Sample Processing</span><p id="par0055" class="elsevierStylePara elsevierViewall">For each participant, a 4-mL sample of peripheral blood was extracted to a K3 ethylenediaminetetraacetic acid tube, which was duly labeled with an identifying code. DNA was extracted using an automated system (MagNa Pure<span class="elsevierStyleSup">®</span> System, Roche Applied Science, USA) and quantified by spectrophotometry (NanoDrop<span class="elsevierStyleSup">®</span> ND-1000, Wilmington DE, USA). Sample purity was determined by measuring the 260<span class="elsevierStyleHsp" style=""></span>nm/280<span class="elsevierStyleHsp" style=""></span>nm signal ratio.</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Polymerase Chain Reaction</span><p id="par0060" class="elsevierStylePara elsevierViewall">Single nucleotide polymorphisms (SNP) were determined by sequencing with different primers. Primers 308F (5′-TTCCTGCATCCTGTCTGGAA-3′) and 238R (5′-CAGCGGAAAACTTCCTTGG-3′) were used for polymorphisms -308 and -238, respectively. These polymorphisms were studied in the same sequence given their proximity to one another on the gene. Primers 857F (5′-AGGAATGGGTTACAGGAGAC-3′) and 857R (GTCCCCTGTATTCCATACCT) were used for polymorphism -857, whereas primers 1031F (5′-TCAGAGAGCTTCAGGGATAT-3′) and 1031R (5′-ACATGTGGCCATATCTCCCA-3′) were used for polymorphism -1031.</p><p id="par0065" class="elsevierStylePara elsevierViewall">The reagent concentrations in the polymerase chain reaction (PCR) were 1X buffer, 2.5<span class="elsevierStyleHsp" style=""></span>mM MgCl<span class="elsevierStyleInf">2</span>, 0.3<span class="elsevierStyleHsp" style=""></span>μM deoxyribonucleotide triphosphate (dNTP), and 1 U/μL Ampli Taq Gold<span class="elsevierStyleSup">©</span> (Applied Biosystems). In addition, for study of the nucleotide at position -1031, we added 5% dimethyl sulfoxide, as this is a region rich in the nitrogenous bases guanine and cytosine.</p><p id="par0070" class="elsevierStylePara elsevierViewall">The PCR product was resolved on a 3% agarose gel and purified with GENECLEAN<span class="elsevierStyleSup">©</span> (MP Biomedicals), according to the manufacturer's instructions. The amplified product was then sequenced.</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Sequencing</span><p id="par0075" class="elsevierStylePara elsevierViewall">Before sequencing, PCR was performed with BigDye<span class="elsevierStyleSup">®</span> Terminator v3.1 (Applied Biosystems), with the first primer applied directly. Following this PCR, the product was purified once again to remove remnants of fluorescently labeled dNTP. Fluorescence was detected by the sequencer (Applied Biosystems). The sequencing results were analyzed using the Chromas V 1.45 software. <a class="elsevierStyleCrossRefs" href="#fig0005">Figures 1 to 4</a> show examples of sequences for polymorphisms at positions -238, -308, -857, and -1031.</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia><elsevierMultimedia ident="fig0015"></elsevierMultimedia><elsevierMultimedia ident="fig0020"></elsevierMultimedia></span></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Statistical Analysis</span><p id="par0080" class="elsevierStylePara elsevierViewall">The SPSS program, version 15.0.1, was used for statistical analysis. For quantitative variables, the Pearson χ<span class="elsevierStyleSup">2</span> test was applied to analyze the differences in genotype frequencies between patients with moderate to severe psoriasis and the group of healthy volunteers for each of the 4 polymorphisms studied.</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Results</span><p id="par0085" class="elsevierStylePara elsevierViewall">We analyzed the DNA from 89 patients and 76 healthy individuals. The epidemiological characteristics of the participants are shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>. Sequencing of the 4 polymorphisms was performed in 70 cases and 69 controls.</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0090" class="elsevierStylePara elsevierViewall">The distribution of allele and genotype frequencies analyzed so far are shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>. Sequencing of polymorphism -238 showed a greater frequency of wild-type allele G, as well as a greater frequency of the genotype with both wild-type alleles (GG) in patients with psoriasis than in the group of healthy volunteers (86.5% vs 70.4%). This difference was statistically significant (<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>.050).</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><p id="par0095" class="elsevierStylePara elsevierViewall">We observed a higher frequency of -308GG in patients than in controls (83.3% vs 78.9%), although this difference was not statistically significant (<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>.478). At position -857, the presence of a genotype with both wild-type alleles (CC) was more frequent in controls (85.5%) than in patients (75.3%), although this difference was also not significant (<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>.262).</p><p id="par0100" class="elsevierStylePara elsevierViewall">For sequencing of polymorphism -1031, we found a higher frequency of the wild-type T allele in patients with psoriasis (80.2% vs 66.7%); 69.4% of the patients had a genotype with both wild-type alleles (TT), whereas this genotype was only present in 45.8% of controls. This difference was statistically significant (<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>.025).</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Discussion</span><p id="par0105" class="elsevierStylePara elsevierViewall">TNF-α is a proinflammatory cytokine implicated in the pathophysiology of psoriasis and other inflammatory diseases such as rheumatoid arthritis and Crohn disease. Several polymorphisms have been associated with psoriasis.</p><p id="par0110" class="elsevierStylePara elsevierViewall">We found an association between some polymorphisms of <span class="elsevierStyleItalic">TNF-α</span> and susceptibility to developing psoriasis. We also found differences in the genetic sequences of the promoter-region polymorphisms <span class="elsevierStyleItalic">TNFα</span> -238 and <span class="elsevierStyleItalic">TNFα</span> -1031 on comparing a population with moderate to severe psoriasis with a population of healthy volunteers. This leads us to think that these polymorphic differences might play an important role in the pathophysiology of psoriasis.</p><p id="par0115" class="elsevierStylePara elsevierViewall">The greater frequency of -238GG and -308GG in patients with psoriasis than in controls could be explained by the greater production of TNF-α in these subjects, as demonstrated in messenger RNA studies performed in other diseases in which TNF-α levels are increased.<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">32</span></a> The greater frequency of -1031TT in patients with psoriasis could also be explained the same way, although few studies of the frequency of this polymorphism in patients with psoriasis have been undertaken and those that have did not find any differences; in addition, there are no relevant in vitro data for this polymorphism.</p><p id="par0120" class="elsevierStylePara elsevierViewall">We observed that the wild-type allele <span class="elsevierStyleItalic">TNFα</span> -238G occurred more frequently in patients with psoriasis (92.6%) than in the control group (83.1%). The GG genotype also occurred more frequently (86.5% vs 70.4%). Most studies published by other authors have found a greater proportion of mutant <span class="elsevierStyleItalic">TNFα</span> -238A allele among patients with psoriasis, as well as an increased risk of psoriasis in association with genotypes with some of the mutant alleles (GA/AA).<a class="elsevierStyleCrossRefs" href="#bib0020"><span class="elsevierStyleSup">4–6,9,33</span></a> However, a recently published study concluded that the -238GG genotype is more frequent among individuals with more severe forms of psoriasis,<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">34</span></a> as was the case in our study. Some studies have found these differences only in patients with early-onset psoriasis,<a class="elsevierStyleCrossRefs" href="#bib0025"><span class="elsevierStyleSup">5,6</span></a> or only in male patients.<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> Studies performed in an oriental population did not find any differences in the distribution of these polymorphisms.<a class="elsevierStyleCrossRefs" href="#bib0035"><span class="elsevierStyleSup">7,35,36</span></a></p><p id="par0125" class="elsevierStylePara elsevierViewall">We did not find any significant differences in the distribution of the <span class="elsevierStyleItalic">TNFα</span> -308 genotype, in line with the findings of other authors.<a class="elsevierStyleCrossRefs" href="#bib0020"><span class="elsevierStyleSup">4,7,9,10,35,36</span></a> However, some studies have found a higher frequency of <span class="elsevierStyleItalic">TNFα</span> -308GG in the case of moderate to severe psoriasis,<a class="elsevierStyleCrossRef" href="#bib0185"><span class="elsevierStyleSup">37</span></a> or a higher frequency of the <span class="elsevierStyleItalic">TNFα</span> -308G allele in patients with early-onset psoriasis.<a class="elsevierStyleCrossRefs" href="#bib0025"><span class="elsevierStyleSup">5,8,33,38</span></a> In a meta-analysis published by Li et al.<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">39</span></a> in 2007, which included studies published to date on polymorphisms of <span class="elsevierStyleItalic">TNF-α</span> at position -238 and -308, the authors concluded that the presence of a wild-type G allele might play a protective role in psoriasis.</p><p id="par0130" class="elsevierStylePara elsevierViewall">Likewise, <span class="elsevierStyleItalic">TNF-α</span> polymorphisms at position -857 did not show any differences in distribution in our study. Similar studies performed in other populations have not found differences in psoriasis,<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a> although a higher frequency of the mutant <span class="elsevierStyleItalic">TNFα</span> -857<span class="elsevierStyleHsp" style=""></span> allele has been observed in patients with psoriatic arthritis compared to healthy volunteers.<a class="elsevierStyleCrossRefs" href="#bib0045"><span class="elsevierStyleSup">9,40</span></a></p><p id="par0135" class="elsevierStylePara elsevierViewall">We found differences in the genotype distribution of <span class="elsevierStyleItalic">TNFα</span> -1031 between patients and controls, with a greater frequency of the wild-type TT genotype among patients. To the best of our knowledge, the only group to have studied this polymorphism did not find statistically significant differences.<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a></p><p id="par0140" class="elsevierStylePara elsevierViewall">We should bear in mind that these differences in the polymorphism of the <span class="elsevierStyleItalic">TNF-α</span> gene in published studies could be due to differences in population or race.<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">41</span></a></p><p id="par0145" class="elsevierStylePara elsevierViewall">Our study is subject to certain limitations. The most important is the small sample size both for patients and controls. In addition, there was a substantial difference in age (and a less marked difference in sex) between cases and controls. However, we do not consider these imbalances to be important because the genotype remains almost completely stable throughout an individual's life. In addition, the fact that we only assessed those patients with moderate to severe psoriasis and that we did not adjust for whether psoriatic arthritis was present may have introduced a bias given the findings of published studies. Finally, patients and controls were drawn from the Communities of Madrid and Castile-La Mancha. The same study with samples from residents of other regions would be needed to determine whether these results can be extrapolated to the Spanish population as a whole.</p><p id="par0150" class="elsevierStylePara elsevierViewall">To perform this study, a gene database was created for the study of the <span class="elsevierStyleItalic">TNF-α</span> polymorphisms. This is very important as, to date, we are unaware of databases for polymorphisms of the <span class="elsevierStyleItalic">TNF-α</span> receptor gene in Spain in psoriasis patients and controls. Moreover, the literature on the subject is limited. Genotyping of these polymorphisms of <span class="elsevierStyleItalic">TNF-α</span> is the first step in the future study of new polymorphisms, both of <span class="elsevierStyleItalic">TNF-α</span> and protein p40, and also of other proteins implicated in the pathophysiology and treatment of psoriasis. In addition, this genetic analysis associated with the assessment of the safety and efficacy of study drugs could allow us to study possible genetic differences between patients according to therapeutic response. The main aim of pharmacogenetics is to establish genetic differences between individuals, and so enable optimization of the treatment of diseases in each patient, thereby ensuring the patient receives safer therapy. This would allow us to avoid delays in the administration of an effective therapy and avoid risks for the patient. It would also prevent unnecessary spending on ineffective treatments.</p><p id="par0155" class="elsevierStylePara elsevierViewall">We should be aware that the genetic profile not only has an influence on the development of a given illness, but also the way in which other genes are expressed.<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">41</span></a> Therefore, it would be interesting to perform future analyses of gene expression by techniques such as DNA microarrays, thereby providing not only a qualitative analysis but also a quantitative one.<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">42</span></a></p><p id="par0160" class="elsevierStylePara elsevierViewall">The aim of this study has thus been to take a further step forward in the field of pharmacogenetics.</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Conclusions</span><p id="par0165" class="elsevierStylePara elsevierViewall">In our study, we would like to highlight that:<ul class="elsevierStyleList" id="lis0005"><li class="elsevierStyleListItem" id="lsti0005"><span class="elsevierStyleLabel">1.</span><p id="par0170" class="elsevierStylePara elsevierViewall">We found significant differences in polymorphism -1031 in psoriasis patients compared to the control group, suggesting that this mutation could play an active part in the pathophysiology of this disease. This finding has not been reported previously in any genetic study of patients with moderate to severe psoriasis.</p></li><li class="elsevierStyleListItem" id="lsti0010"><span class="elsevierStyleLabel">2.</span><p id="par0175" class="elsevierStylePara elsevierViewall">We also found relevant differences in polymorphism -238, and so this mutation may also participate in the genesis of this disease. This finding has not been reported previously in Spanish patients with moderate to severe psoriasis.</p></li><li class="elsevierStyleListItem" id="lsti0015"><span class="elsevierStyleLabel">3.</span><p id="par0180" class="elsevierStylePara elsevierViewall">Detection of these polymorphisms is of notable practical worth as, for present or future studies, it would enable:<ul class="elsevierStyleList" id="lis0010"><li class="elsevierStyleListItem" id="lsti0020"><span class="elsevierStyleLabel">a.</span><p id="par0185" class="elsevierStylePara elsevierViewall">creation of a gene bank with blood samples obtained from patients with plaque psoriasis;</p></li><li class="elsevierStyleListItem" id="lsti0025"><span class="elsevierStyleLabel">b.</span><p id="par0190" class="elsevierStylePara elsevierViewall">study of the pathogenic mechanisms underlying psoriasis;</p></li><li class="elsevierStyleListItem" id="lsti0030"><span class="elsevierStyleLabel">c.</span><p id="par0195" class="elsevierStylePara elsevierViewall">identification of other possible therapeutic targets;</p></li><li class="elsevierStyleListItem" id="lsti0035"><span class="elsevierStyleLabel">d.</span><p id="par0200" class="elsevierStylePara elsevierViewall">correlation of these results with treatment response and toxicity, whereby we would achieve:<ul class="elsevierStyleList" id="lis0015"><li class="elsevierStyleListItem" id="lsti0040"><span class="elsevierStyleLabel">-</span><p id="par0205" class="elsevierStylePara elsevierViewall">an increase in the knowledge of the mechanism of action at the molecular level of the study drugs and</p></li><li class="elsevierStyleListItem" id="lsti0045"><span class="elsevierStyleLabel">-</span><p id="par0210" class="elsevierStylePara elsevierViewall">determination a priori of the drug of choice (personalized medicine).</p></li></ul></p></li></ul></p></li></ul></p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Funding</span><p id="par0215" class="elsevierStylePara elsevierViewall">This study received financial support from the Fundación Salud 2000 and was partially funded by the FIS PI10-01740 project. The study was awarded the Juan de Azúa prize in 2010 by the Spanish Academy for Dermatology and Venereology.</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle">Conflicts of Interest</span><p id="par0220" class="elsevierStylePara elsevierViewall">The authors declare that they have no conflicts of interest.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:14 [ 0 => array:2 [ "identificador" => "xres95890" "titulo" => array:6 [ 0 => "Abstract" 1 => "Background" 2 => "Objective" 3 => "Material and methods" 4 => "Results" 5 => "Conclusion" ] ] 1 => array:2 [ "identificador" => "xpalclavsec83050" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "xres95891" "titulo" => array:6 [ 0 => "Resumen" 1 => "Introducción" 2 => "Objetivo" 3 => "Material y métodos" 4 => "Resultados" 5 => "Conclusión" ] ] 3 => array:2 [ "identificador" => "xpalclavsec83049" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:2 [ "identificador" => "sec0010" "titulo" => "Objective" ] 6 => array:3 [ "identificador" => "sec0015" "titulo" => "Materials and Methods" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "sec0020" "titulo" => "Study Design" ] 1 => array:2 [ "identificador" => "sec0025" "titulo" => "Sample Processing" ] 2 => array:2 [ "identificador" => "sec0030" "titulo" => "Polymerase Chain Reaction" ] 3 => array:2 [ "identificador" => "sec0035" "titulo" => "Sequencing" ] ] ] 7 => array:2 [ "identificador" => "sec0040" "titulo" => "Statistical Analysis" ] 8 => array:2 [ "identificador" => "sec0045" "titulo" => "Results" ] 9 => array:2 [ "identificador" => "sec0050" "titulo" => "Discussion" ] 10 => array:2 [ "identificador" => "sec0055" "titulo" => "Conclusions" ] 11 => array:2 [ "identificador" => "sec0060" "titulo" => "Funding" ] 12 => array:2 [ "identificador" => "sec0065" "titulo" => "Conflicts of Interest" ] 13 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2011-05-06" "fechaAceptado" => "2011-10-02" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec83050" "palabras" => array:3 [ 0 => "Psoriasis" 1 => "Tumor necrosis factor" 2 => "Polymorphisms" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec83049" "palabras" => array:3 [ 0 => "Psoriasis" 1 => "Factor necrosis tumoral" 2 => "Polimorfismos" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:2 [ "titulo" => "Abstract" "resumen" => "<span class="elsevierStyleSectionTitle">Background</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Several studies have reported an association between tumor necrosis factor α (TNF-α) polymorphisms and inflammatory diseases such as psoriasis vulgaris and psoriatic arthritis, although the results vary according to the population studied. No studies have been performed in the Spanish population.</p> <span class="elsevierStyleSectionTitle">Objective</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">To analyze the polymorphisms of the promoter region of the <span class="elsevierStyleItalic">TNF-α</span> gene in patients with moderate to severe psorasis and to identify potential differences in genotype compared to a group of healthy volunteers.</p> <span class="elsevierStyleSectionTitle">Material and methods</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Eighty-nine patients with moderate to severe psoriasis and 76 healthy controls with no personal or family history of psoriasis were selected. Polymorphisms of the <span class="elsevierStyleItalic">TNF-α</span> promoter region of both groups were genotyped.</p> <span class="elsevierStyleSectionTitle">Results</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">We observed a higher prevalence of the genotype with both wild-type alleles at positions -238 (GG genotype, 86.5% vs 70.4%, respectively) and -1031 (TT genotype, 80.2% vs 45.8%, respectively) in patients compared to the healthy control group. The differences at positions -308 and -857 were not significant.</p> <span class="elsevierStyleSectionTitle">Conclusion</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">There are differences in polymorphisms at positions -238 and -1031 in patients with moderate to severe psoriasis compared to healthy volunteers. This observation provides further support for the importance of the part that TNF-α plays in the pathophysiology of this disease.</p>" ] "es" => array:2 [ "titulo" => "Resumen" "resumen" => "<span class="elsevierStyleSectionTitle">Introducción</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">En diversos estudios se ha descrito la asociación de los polimorfismos del factor de necrosis tumoral α (TNF-α) y patologías inflamatorias como la psoriasis vulgar y la artritis psoriásica, aunque los resultados son variables según la población de origen de la muestra. No se han realizado estudios previamente en población española.</p> <span class="elsevierStyleSectionTitle">Objetivo</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Analizar los polimorfismos de la región promotora del gen del TNF-α en pacientes con psoriasis moderada-grave y establecer las posibles diferencias genotípicas con los hallados en un grupo de voluntarios sanos.</p> <span class="elsevierStyleSectionTitle">Material y métodos</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Se seleccionaron 89 pacientes con psoriasis moderada-grave y 76 controles sin antecedentes familiares ni personales de psoriasis. Se genotiparon los polimorfismos de la región promotora del gen del TNF-α en ambos grupos.</p> <span class="elsevierStyleSectionTitle">Resultados</span><p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Observamos una mayor prevalencia de genotipo con ambos alelos en estado silvestre en posición -238 (GG, 86,5% vs 70,4% respectivamente) y -1031 (TT, 80,2% vs 45,8% respectivamente) en el grupo de pacientes con psoriasis al compararlo con el grupo control. Las diferencias halladas en posición -308 y -857 no fueron significativas.</p> <span class="elsevierStyleSectionTitle">Conclusión</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Existen diferencias en los polimorfismos en las posiciones -238 y -1031 entre pacientes con psoriasis moderada-grave y voluntarios sanos, lo cual apoya la importancia del papel del TNF-α en la fisiopatología de esta entidad.</p>" ] ] "NotaPie" => array:1 [ 0 => array:2 [ "etiqueta" => "☆" "nota" => "<p class="elsevierStyleNotepara">Please cite this article as. Gallo E, et al. Estudio de los polimorfismos genéticos de la región promotora del TNF-α en pacientes españoles afectos de psoriasis. Actas Dermosifiliogr.2012;103:301-7.</p>" ] ] "multimedia" => array:6 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 950 "Ancho" => 1583 "Tamanyo" => 144996 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Example of a sequence for polymorphism -238 (A/G).</p>" ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 856 "Ancho" => 1583 "Tamanyo" => 153974 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Example of a sequence for polymorphism -308 (G/A).</p>" ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1070 "Ancho" => 2257 "Tamanyo" => 354409 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Example of a sequence for polymorphism -857 (T/C).</p>" ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 869 "Ancho" => 1583 "Tamanyo" => 145039 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Example of a sequence for polymorphism -1031 (T/C).</p>" ] ] 4 => array:7 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Controls (n<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>76) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Cases (n<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>89) \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Mean age, y (range)</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">22.60 (18-31) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">48.17 (19-80) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="3" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="3" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Sex</span></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male, % \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">46% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">51.7% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Female, % \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">54% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">48.3% \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male/female ratio \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.2/1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.9/1 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="3" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Inclusion criteria</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Healthy volunteers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Moderate to severe psoriasis \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Lack of family and personal history of psoriasis \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Nonsmokers \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab182133.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Characteristics of Cases and Controls.</p>" ] ] 5 => array:7 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "tabla" => array:2 [ "leyenda" => "<p id="spar0085" class="elsevierStyleSimplePara elsevierViewall">Abbreviation: SNP, single nucleotide polymorphism.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SNP (No. Patients) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Cases</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="2" align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Controls</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">P</span> Value for Statistical Significance (Genotype Frequencies) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Allele Frequencies \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Genotype Frequencies \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Allele Frequencies \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black">Genotype Frequencies \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t" style="border-bottom: 2px solid black"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">-238 G→A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G 92.6%A 7.4% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G/G 70/81 (86.5%)A/G 10/81 (12.3%)A/A 1/81 (1.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G 83.1%A 16.9% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G/G 50/71 (70.4%)A/G 18/71 (25.4%)A/A 3/71 (4.2%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>.050 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">-308 G→A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G 91.7%A 8.3% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G/G 70/84 (83.3%)A/G 14/84 (16.7%)A/A 0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G 89.5%A 10.5% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G/G 60/76 (78.9%)A/G 16/76 (21.1%)A/A 0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>.478 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">-857 C→T \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">C 87%T 13% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">C/C 58/77 (75.3%)C/T 18/77 (23.4%)T/T 1/77 (1.3%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">C 92.1%T 7.9% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">C/C 65/76 (85.5%)C/T 10/76 (13.2%)T/T 1/76 (1.3%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>.262 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">-1031 T→C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">T 80.2%C 19.8% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">T/T 55/86 (69.4%)T/C 28/86 (28.6%)C/C 3/86 (2.0%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">T 66.7%C 33.3% \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">T/T 33/72 (45.8%)T/C 30/72 (41.7%)C/C 9/72 (12.5%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>.025 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab182134.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">Comparison of Allele and Genotype Frequencies Between Cases and Controls.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:42 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Farmacogenética I. Concepto, historia, objetivos y áreas de estudio" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "E. Daudén" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Actas Demosifiliogr" "fecha" => "2006" "volumen" => "97" "paginaInicial" => "623" "paginaFinal" => "626" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hypothesis: comparison of inter- and intra-individual variations can substitute for twin studies in drug research" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "W. Kalow" 1 => "B.K. Tang" 2 => "I. Endrenyi" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Pharmacogenetics" "fecha" => "1998" "volumen" => "8" "paginaInicial" => "283" "paginaFinal" => "289" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9731714" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The genetic basis of psoriasis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "H. Valdimarsson" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.clindermatol.2007.08.010" "Revista" => array:6 [ "tituloSerie" => "Clin Dermatol" "fecha" => "2007" "volumen" => "25" "paginaInicial" => "563" "paginaFinal" => "567" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18021893" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A TNF-alpha promoter polymorphism is associated with juvenile onset psoriasis and psoriatic arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T. Höhler" 1 => "A. Kruger" 2 => "P.M. Schneider" 3 => "R.E. Schopf" 4 => "J. Knop" 5 => "C. Rittner" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Invest Dermatol" "fecha" => "1997" "volumen" => "109" "paginaInicial" => "562" "paginaFinal" => "565" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9326391" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Combined analysis of polymorphisms of the tumor necrosis factor-alpha and interleukin-10 promoter regions and polymorphic xenobiotic metabolizing enzymes in psoriasis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K. Reich" 1 => "G. Westphal" 2 => "T. Schulz" 3 => "M. Müller" 4 => "S. Zipprich" 5 => "T. Fuchs" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1046/j.1523-1747.1999.00654.x" "Revista" => array:6 [ "tituloSerie" => "J Invest Dermatol" "fecha" => "1999" "volumen" => "113" "paginaInicial" => "214" "paginaFinal" => "220" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10469306" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Promoter polymorphisms of the genes encoding tumor necrosis factor-alpha and interleukin-1beta are associated with different subtypes of psoriasis characterized by early and late disease onset" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "K. Reich" 1 => "R. Mössner" 2 => "I.R. König" 3 => "G. Westphal" 4 => "A. Ziegler" 5 => "C. Neumann" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1046/j.0022-202x.2001.01642.x" "Revista" => array:6 [ "tituloSerie" => "J Invest Dermatol" "fecha" => "2002" "volumen" => "118" "paginaInicial" => "155" "paginaFinal" => "163" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11851889" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Lack of association of TNF-238A and -308A in Japanese patients with psoriasis vulgaris, psoriatic arthritis and generalized pustular psoriasis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "A. Nishibu" 1 => "N. Oyama" 2 => "K. Nakamura" 3 => "F. Kaneko" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Dermatol Sci" "fecha" => "2002" "volumen" => "29" "paginaInicial" => "181" "paginaFinal" => "184" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12234707" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Associations of promoter region polymorphisms in the tumour necrosis factor-alpha gene and early-onset psoriasis vulgaris in a northern Polish population" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "B. Nedoszytko" 1 => "A. Szczerkowska-Dobosz" 2 => "M. Zabłotna" 3 => "J. Gleń" 4 => "K. Rebała" 5 => "J. Roszkiewicz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-2133.2007.07993.x" "Revista" => array:6 [ "tituloSerie" => "Br J Dermatol" "fecha" => "2007" "volumen" => "157" "paginaInicial" => "165" "paginaFinal" => "167" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17553030" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "TNF polymorphisms in psoriasis: association of psoriatic arthritis with the promoter polymorphism TNF*-857 independent of the PSORS1 risk allele" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K. Reich" 1 => "U. Hüffmeier" 2 => "I.R. König" 3 => "J. Lascorz" 4 => "J. Lohmann" 5 => "J. Wendler" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/art.22590" "Revista" => array:6 [ "tituloSerie" => "Arthritis Rheum" "fecha" => "2007" "volumen" => "56" "paginaInicial" => "2056" "paginaFinal" => "2064" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17530646" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A - 308 promoter polymorphism of tumor necrosis factor alpha gene does not associate with the susceptibility to psoriasis vulgaris. No difference either between psoriasis type I and type II patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "W. Baran" 1 => "J.C. Szepietowski" 2 => "G. Mazur" 3 => "E. Baran" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Acta Dermatovenerol Alp Panonica Adriat" "fecha" => "2006" "volumen" => "15" "paginaInicial" => "113" "paginaFinal" => "118" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17053845" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "IL-10 promoter polymorphisms influence disease severity and course in psoriasis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "K. Kingo" 1 => "S. Kõks" 2 => "H. Silm" 3 => "E. Vasar" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.gene.6364004" "Revista" => array:6 [ "tituloSerie" => "Genes Immun" "fecha" => "2003" "volumen" => "4" "paginaInicial" => "455" "paginaFinal" => "457" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12944983" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "IL-6 and IL-10 promoter gene polymorphisms in psoriasis vulgaris" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "W. Baran" 1 => "J.C. Szepietowski" 2 => "G. Mazur" 3 => "E. Baran" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2340/00015555-0427" "Revista" => array:6 [ "tituloSerie" => "Acta Derm Venereol" "fecha" => "2008" "volumen" => "88" "paginaInicial" => "113" "paginaFinal" => "116" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18311435" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Polymorphisms of the IL12B and IL23R genes are associated with psoriasis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R.P. Nair" 1 => "A. Ruether" 2 => "P.E. Stuart" 3 => "S. Jenisch" 4 => "T. Tejasvi" 5 => "R. Hiremagalore" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.jid.5701255" "Revista" => array:7 [ "tituloSerie" => "J Invest Dermatol" "fecha" => "2008" "volumen" => "128" "paginaInicial" => "1653" "paginaFinal" => "1661" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18219280" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0002939410006628" "estado" => "S300" "issn" => "00029394" ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic variations in cytokines and cytokine receptors associated with psoriasis found by genome-wide association" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "K.C. Duffin" 1 => "G.G. Krueger" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/jid.2008.308" "Revista" => array:6 [ "tituloSerie" => "J Invest Dermatol" "fecha" => "2009" "volumen" => "129" "paginaInicial" => "827" "paginaFinal" => "833" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18830267" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic variation and psoriasis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "J.E. Gudjonsson" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "G Ital Dermatol Venereol" "fecha" => "2008" "volumen" => "143" "paginaInicial" => "299" "paginaFinal" => "305" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18833071" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "TGF-beta(1) gene polymorphism in psoriasis vulgaris" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "W. Baran" 1 => "J.C. Szepietowski" 2 => "G. Mazur" 3 => "E. Baran" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.cyto.2007.04.004" "Revista" => array:6 [ "tituloSerie" => "Cytokine" "fecha" => "2007" "volumen" => "38" "paginaInicial" => "8" "paginaFinal" => "11" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17560118" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "IFN-gamma promoter gene polymorphism in psoriasis vulgaris" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "W. Baran" 1 => "J.C. Szepietowski" 2 => "G. Mazur" 3 => "E. Baran" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1080/13547500701610273" "Revista" => array:6 [ "tituloSerie" => "Biomarkers" "fecha" => "2008" "volumen" => "13" "paginaInicial" => "52" "paginaFinal" => "58" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17852079" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The TNF superfamily in 2009: new pathways, new indications, and new drugs" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.G. Tansey" 1 => "D.E. Szymkowski" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.drudis.2009.10.002" "Revista" => array:6 [ "tituloSerie" => "Drug Discov Today" "fecha" => "2009" "volumen" => "14" "paginaInicial" => "1082" "paginaFinal" => "1088" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19837186" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Tumor necrosis factor blockade: mechanism of action" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "A.B. Gottlieb" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.jidsymp.5650045" "Revista" => array:6 [ "tituloSerie" => "J Investig Dermatol Symp Proc" "fecha" => "2007" "volumen" => "12" "paginaInicial" => "1" "paginaFinal" => "4" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18004287" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Binding characteristics of tumor necrosis factor receptor-Fc fusion proteins vs anti-tumor necrosis factor mAbs" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "T. Kohno" 1 => "L.T. Tam" 2 => "S.R. Stevens" 3 => "J.S. Louie" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.jidsymp.5650034" "Revista" => array:6 [ "tituloSerie" => "J Investig Dermatol Symp Proc" "fecha" => "2007" "volumen" => "12" "paginaInicial" => "5" "paginaFinal" => "8" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17502862" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular pathophysiology of psoriasis and molecular targets of antipsoriatic therapy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "E. Rácz" 1 => "E.P. Prens" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Expert Rev Mol Med" "fecha" => "2009" "volumen" => "11" "paginaInicial" => "1" "paginaFinal" => "18" ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Papel de los polimorfismos -238 y -308 del promotor del factor de necrosis tumoral alfa en la patogenia y respuesta a tratamiento anti- factor de necrosis tumoral alfa en artritis reumatoide" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C. Llanos" 1 => "L. Soto" 2 => "F. Sabugo" 3 => "M.J. Bastías" 4 => "L. Salazar" 5 => "J. Aguillón" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "/S0034-98872005000900014" "Revista" => array:6 [ "tituloSerie" => "Rev Méd Chile" "fecha" => "2005" "volumen" => "133" "paginaInicial" => "1089" "paginaFinal" => "1095" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16311703" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Polymorphism at position -308 of the tumor necrosis factor alpha gene influences outcome of infliximab therapy in rheumatoid arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "B. Mugnier" 1 => "N. Balandraud" 2 => "A. Darque" 3 => "C. Roudier" 4 => "J. Roudier" 5 => "D. Reviron" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/art.11168" "Revista" => array:6 [ "tituloSerie" => "Arthritis Rheum" "fecha" => "2003" "volumen" => "48" "paginaInicial" => "1849" "paginaFinal" => "1852" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12847678" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Tumour necrosis factor-alpha (TNF-alpha) levels and influence of -308 TNF-alpha promoter polymorphism on the responsiveness to infliximab in patients with rheumatoid arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Cuchacovich" 1 => "L. Ferreira" 2 => "M. Aliste" 3 => "L. Soto" 4 => "J. Cuenca" 5 => "A. Cruzat" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1080/03009740410005863" "Revista" => array:6 [ "tituloSerie" => "Scand J Rheumatol" "fecha" => "2004" "volumen" => "33" "paginaInicial" => "228" "paginaFinal" => "232" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15370717" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Tumour necrosis factor (TNF)alpha -308 G/G promoter polymorphism and TNFalpha levels correlate with a better response to adalimumab in patients with rheumatoid arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Cuchacovich" 1 => "L. Soto" 2 => "M. Edwardes" 3 => "M. Gutierrez" 4 => "C. Llanos" 5 => "D. Pacheco" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Scand J Rheumatol" "fecha" => "2006" "volumen" => "35" "paginaInicial" => "435" "paginaFinal" => "440" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17343250" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Influence of -308 A/G polymorphism in the tumor necrosis factor alpha gene on etanercept treatment in rheumatoid arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Guis" 1 => "N. Balandraud" 2 => "J. Bouvenot" 3 => "I. Auger" 4 => "E. Toussirot" 5 => "D. Wendling" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/art.23092" "Revista" => array:6 [ "tituloSerie" => "Arthritis Rheum" "fecha" => "2007" "volumen" => "57" "paginaInicial" => "1426" "paginaFinal" => "1430" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18050183" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0135" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The -308 tumour necrosis factor-alpha gene polymorphism predicts therapeutic response to TNFalpha-blockers in rheumatoid arthritis and spondyloarthritis patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M. Seitz" 1 => "U. Wirthmüller" 2 => "B. Möller" 3 => "P.M. Villiger" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rheumatology (Oxford)" "fecha" => "2007" "volumen" => "46" "paginaInicial" => "93" "paginaFinal" => "96" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0140" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Psoriatic arthritis: genetic susceptibility and pharmacogenetics" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "P. Rahman" 1 => "D.D. O‘Rielly" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2217/14622416.9.2.195" "Revista" => array:6 [ "tituloSerie" => "Pharmacogenomics" "fecha" => "2008" "volumen" => "9" "paginaInicial" => "195" "paginaFinal" => "205" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18370848" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0145" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A single tumour necrosis factor haplotype influences the response to adalimumab in rheumatoid arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C. Miceli-Richard" 1 => "E. Comets" 2 => "C. Verstuyft" 3 => "R. Tamouza" 4 => "P. Loiseau" 5 => "P. Ravaud" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/ard.2007.074104" "Revista" => array:6 [ "tituloSerie" => "Ann Rheum Dis" "fecha" => "2008" "volumen" => "67" "paginaInicial" => "478" "paginaFinal" => "484" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17673491" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0150" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The influence of a polymorphism at position -857 of the tumour necrosis factor alpha gene on clinical response to etanercept therapy in rheumatoid arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "C.P. Kang" 1 => "K.W. Lee" 2 => "D.H. Yoo" 3 => "C. Kang" 4 => "S.C. Bae" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rheumatology (Oxford)" "fecha" => "2005" "volumen" => "44" "paginaInicial" => "547" "paginaFinal" => "552" ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0155" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pharmacogenetics of anti-TNF treatment in patients with rheumatoid arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M.J. Coenen" 1 => "E.J. Toonen" 2 => "H. Scheffer" 3 => "T.R. Radstake" 4 => "P. Barrera" 5 => "B. Franke" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2217/14622416.8.7.761" "Revista" => array:6 [ "tituloSerie" => "Pharmacogenomics" "fecha" => "2007" "volumen" => "8" "paginaInicial" => "761" "paginaFinal" => "773" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17638513" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0160" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Tumor necrosis factor α-308 and -238 polymorphisms in rheumatoid arthritis. Association with messenger RNA expression and sTNF-α" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E. Oregón-Romero" 1 => "M. Vázquez-Del Mercado" 2 => "S.L. Ruiz-Quezada" 3 => "R.E. Navarro-Hernández" 4 => "H. Rangel-Villalobos" 5 => "G. Martínez-Bonilla" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Invest Med" "fecha" => "2008" "volumen" => "56" "paginaInicial" => "937" "paginaFinal" => "943" ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0165" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of TNF–238 and–308 promoter polymorphisms with psoriasis vulgaris and psoriatic arthitis but not with pustulosis palmoplantaris" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "R. Mössner" 1 => "K. Kingo" 2 => "A. Kleensang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.0022-202X.2004.23556.x" "Revista" => array:6 [ "tituloSerie" => "J Invest Dermatol" "fecha" => "2005" "volumen" => "124" "paginaInicial" => "282" "paginaFinal" => "284" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15654990" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0170" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Human leukocyte antigen (HLA) and single nucleotide polymorphisms (SNPs) tumor necrosis factor (TNF)-alpha and -308 as genetic markers of susceptibilitiy to psoriasis and severity of the disease in a long-term follow-up Brazilians" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R.F. Magalhaes" 1 => "A.C. Biral" 2 => "J.A. Pancoto" 3 => "A.E. Donadi" 4 => "C.T. Mendes" 5 => "L.A. Magna" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Int J Dermatol" "fecha" => "2010" "volumen" => "49" "paginaInicial" => "1133" "paginaFinal" => "1140" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20931685" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0161642008000699" "estado" => "S300" "issn" => "01616420" ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0175" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Polymorphisms of tumor necrosis factor (TNF) α and β genes in Korean patients with psoriasis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T.G. Kim" 1 => "C.W. Pyo" 2 => "S.S. Hur" 3 => "Y.K. Kim" 4 => "H.Y. Hwang" 5 => "J.I. Youn" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00403-003-0392-9" "Revista" => array:6 [ "tituloSerie" => "Arch Dermatol Res" "fecha" => "2003" "volumen" => "295" "paginaInicial" => "8" "paginaFinal" => "13" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12709814" "web" => "Medline" ] ] ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0180" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Lack of association between the promoter polymorphisms at positions -308 and -238 of the tumor necrosis factor alpha gene and psoriasis vulgaris in Japanese patients" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Tsunemi" 1 => "A. Nishibu" 2 => "H. Saeki" 3 => "N. Oyama" 4 => "K. Nakamura" 5 => "M. Kishimoto" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "74117" "Revista" => array:6 [ "tituloSerie" => "Dermatology" "fecha" => "2003" "volumen" => "207" "paginaInicial" => "371" "paginaFinal" => "374" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14657629" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0185" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of cytokine gene polymorphisms with psoriasis in cases from the Nile Delta of Egypt" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "A. Settin" 1 => "H. Hassan" 2 => "R. El-Baz" 3 => "T. Hassan" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Acta Dermatoven APA" "fecha" => "2009" "volumen" => "18" "paginaInicial" => "105" "paginaFinal" => "112" ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0190" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Cytokine gene polymorphism in psoriasis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "N. Craven" 1 => "C. Jackson" 2 => "B. Kirby" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Br J Dermatol" "fecha" => "2001" "volumen" => "144" "paginaInicial" => "849" "paginaFinal" => "853" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11298547" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0195" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "TNF-alpha gene promoter -238G<span class="elsevierStyleHsp" style=""></span>><span class="elsevierStyleHsp" style=""></span>A and -308G<span class="elsevierStyleHsp" style=""></span>><span class="elsevierStyleHsp" style=""></span>A polymorphisms alter risk of psoriasis vulgaris: a meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "C. Li" 1 => "G. Wang" 2 => "Y. Gao" 3 => "L. Liu" 4 => "T. Gao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/sj.jid.5700822" "Revista" => array:6 [ "tituloSerie" => "J Invest Dermatol" "fecha" => "2007" "volumen" => "127" "paginaInicial" => "1886" "paginaFinal" => "1892" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17446901" "web" => "Medline" ] ] ] ] ] ] ] ] 39 => array:3 [ "identificador" => "bib0200" "etiqueta" => "40" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "TNFα polymorphisms and risk of psoriatic arthritis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "P. Rahman" 1 => "F. Siannis" 2 => "C. Butt" 3 => "V. Farewell" 4 => "L. Peddle" 5 => "F. Pellett" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/ard.2005.039164" "Revista" => array:6 [ "tituloSerie" => "Ann Rheum Dis" "fecha" => "2006" "volumen" => "65" "paginaInicial" => "919" "paginaFinal" => "923" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16284098" "web" => "Medline" ] ] ] ] ] ] ] ] 40 => array:3 [ "identificador" => "bib0205" "etiqueta" => "41" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular classification of psoriasis disease-associated genes through pharmacogenomic expression profiling" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.L. Oestreicher" 1 => "I.B. Walters" 2 => "T. Kikuchi" 3 => "P. Gilleaudeau" 4 => "J. Surette" 5 => "U. Schwertschlag" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Pharmacogenomics J" "fecha" => "2001" "volumen" => "1" "paginaInicial" => "272" "paginaFinal" => "287" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11911124" "web" => "Medline" ] ] ] ] ] ] ] ] 41 => array:3 [ "identificador" => "bib0210" "etiqueta" => "42" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Farmacogenética II. Métodos moleculares de estudio, bioinformática y aspectos éticos" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "E. Daudén" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Actas Dermosifiliogr" "fecha" => "2007" "volumen" => "98" "paginaInicial" => "3" "paginaFinal" => "13" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17374327" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/15782190/0000010300000004/v1_201304241303/S1578219012001424/v1_201304241303/en/main.assets" "Apartado" => array:4 [ "identificador" => "6155" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original Articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/15782190/0000010300000004/v1_201304241303/S1578219012001424/v1_201304241303/en/main.pdf?idApp=UINPBA000044&text.app=https://actasdermo.org/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S1578219012001424?idApp=UINPBA000044" ]
| año/Mes | Html | Total | |
|---|---|---|---|
| 2024 Noviembre | 6 | 13 | 19 |
| 2024 Octubre | 70 | 40 | 110 |
| 2024 Septiembre | 61 | 32 | 93 |
| 2024 Agosto | 98 | 66 | 164 |
| 2024 Julio | 53 | 23 | 76 |
| 2024 Junio | 87 | 25 | 112 |
| 2024 Mayo | 58 | 30 | 88 |
| 2024 Abril | 68 | 27 | 95 |
| 2024 Marzo | 57 | 25 | 82 |
| 2024 Febrero | 49 | 42 | 91 |
| 2024 Enero | 51 | 33 | 84 |
| 2023 Diciembre | 57 | 15 | 72 |
| 2023 Noviembre | 64 | 25 | 89 |
| 2023 Octubre | 55 | 27 | 82 |
| 2023 Septiembre | 50 | 31 | 81 |
| 2023 Agosto | 41 | 15 | 56 |
| 2023 Julio | 51 | 40 | 91 |
| 2023 Junio | 52 | 24 | 76 |
| 2023 Mayo | 46 | 22 | 68 |
| 2023 Abril | 49 | 22 | 71 |
| 2023 Marzo | 43 | 33 | 76 |
| 2023 Febrero | 54 | 22 | 76 |
| 2023 Enero | 40 | 24 | 64 |
| 2022 Diciembre | 62 | 46 | 108 |
| 2022 Noviembre | 29 | 25 | 54 |
| 2022 Octubre | 24 | 30 | 54 |
| 2022 Septiembre | 31 | 39 | 70 |
| 2022 Agosto | 33 | 32 | 65 |
| 2022 Julio | 26 | 35 | 61 |
| 2022 Junio | 27 | 27 | 54 |
| 2022 Mayo | 45 | 36 | 81 |
| 2022 Abril | 51 | 37 | 88 |
| 2022 Marzo | 38 | 59 | 97 |
| 2022 Febrero | 40 | 34 | 74 |
| 2022 Enero | 30 | 39 | 69 |
| 2021 Diciembre | 20 | 36 | 56 |
| 2021 Noviembre | 34 | 45 | 79 |
| 2021 Octubre | 32 | 63 | 95 |
| 2021 Septiembre | 30 | 35 | 65 |
| 2021 Agosto | 37 | 39 | 76 |
| 2021 Julio | 23 | 27 | 50 |
| 2021 Junio | 28 | 31 | 59 |
| 2021 Mayo | 26 | 39 | 65 |
| 2021 Abril | 40 | 34 | 74 |
| 2021 Marzo | 75 | 24 | 99 |
| 2021 Febrero | 57 | 28 | 85 |
| 2021 Enero | 36 | 19 | 55 |
| 2020 Diciembre | 37 | 10 | 47 |
| 2020 Noviembre | 20 | 29 | 49 |
| 2020 Octubre | 26 | 20 | 46 |
| 2020 Septiembre | 33 | 12 | 45 |
| 2020 Agosto | 21 | 17 | 38 |
| 2020 Julio | 26 | 17 | 43 |
| 2020 Junio | 37 | 29 | 66 |
| 2020 Mayo | 30 | 12 | 42 |
| 2020 Abril | 41 | 18 | 59 |
| 2020 Marzo | 33 | 26 | 59 |
| 2020 Febrero | 4 | 8 | 12 |
| 2020 Enero | 4 | 10 | 14 |
| 2019 Diciembre | 8 | 2 | 10 |
| 2019 Noviembre | 4 | 0 | 4 |
| 2019 Septiembre | 4 | 0 | 4 |
| 2019 Agosto | 4 | 2 | 6 |
| 2019 Julio | 8 | 8 | 16 |
| 2019 Junio | 4 | 16 | 20 |
| 2019 Mayo | 6 | 14 | 20 |
| 2019 Abril | 2 | 15 | 17 |
| 2019 Marzo | 0 | 9 | 9 |
| 2019 Febrero | 4 | 3 | 7 |
| 2019 Enero | 0 | 4 | 4 |
| 2018 Diciembre | 4 | 8 | 12 |
| 2018 Noviembre | 2 | 0 | 2 |
| 2018 Octubre | 2 | 0 | 2 |
| 2018 Septiembre | 3 | 0 | 3 |
| 2018 Marzo | 0 | 1 | 1 |
| 2018 Febrero | 32 | 2 | 34 |
| 2018 Enero | 39 | 10 | 49 |
| 2017 Diciembre | 36 | 14 | 50 |
| 2017 Noviembre | 41 | 13 | 54 |
| 2017 Octubre | 38 | 7 | 45 |
| 2017 Septiembre | 35 | 3 | 38 |
| 2017 Agosto | 60 | 9 | 69 |
| 2017 Julio | 46 | 8 | 54 |
| 2017 Junio | 68 | 19 | 87 |
| 2017 Mayo | 47 | 6 | 53 |
| 2017 Abril | 39 | 8 | 47 |
| 2017 Marzo | 42 | 34 | 76 |
| 2017 Febrero | 32 | 11 | 43 |
| 2017 Enero | 24 | 6 | 30 |
| 2016 Diciembre | 40 | 10 | 50 |
| 2016 Noviembre | 65 | 6 | 71 |
| 2016 Octubre | 72 | 12 | 84 |
| 2016 Septiembre | 55 | 11 | 66 |
| 2016 Agosto | 57 | 14 | 71 |
| 2016 Julio | 39 | 12 | 51 |
| 2016 Junio | 10 | 15 | 25 |
| 2016 Mayo | 3 | 15 | 18 |
| 2016 Abril | 5 | 2 | 7 |
| 2016 Marzo | 12 | 2 | 14 |
| 2016 Febrero | 10 | 1 | 11 |
| 2016 Enero | 7 | 1 | 8 |
| 2015 Diciembre | 7 | 5 | 12 |
| 2015 Noviembre | 10 | 3 | 13 |
| 2015 Octubre | 14 | 2 | 16 |
| 2015 Septiembre | 3 | 1 | 4 |
| 2015 Agosto | 17 | 2 | 19 |
| 2015 Julio | 64 | 6 | 70 |
| 2015 Junio | 53 | 15 | 68 |
| 2015 Mayo | 85 | 16 | 101 |
| 2015 Abril | 66 | 17 | 83 |
| 2015 Marzo | 59 | 10 | 69 |
| 2015 Febrero | 57 | 11 | 68 |
| 2015 Enero | 86 | 25 | 111 |
| 2014 Diciembre | 88 | 10 | 98 |
| 2014 Noviembre | 81 | 13 | 94 |
| 2014 Octubre | 94 | 18 | 112 |
| 2014 Septiembre | 68 | 16 | 84 |
| 2014 Agosto | 66 | 14 | 80 |
| 2014 Julio | 84 | 21 | 105 |
| 2014 Junio | 86 | 15 | 101 |
| 2014 Mayo | 83 | 17 | 100 |
| 2014 Abril | 41 | 3 | 44 |
| 2014 Marzo | 45 | 5 | 50 |
| 2014 Febrero | 34 | 7 | 41 |
| 2014 Enero | 34 | 10 | 44 |
| 2013 Diciembre | 34 | 10 | 44 |
| 2013 Noviembre | 29 | 10 | 39 |
| 2013 Octubre | 13 | 10 | 23 |
| 2013 Septiembre | 24 | 4 | 28 |
| 2013 Agosto | 22 | 20 | 42 |
| 2013 Julio | 7 | 24 | 31 |
| 2013 Junio | 13 | 25 | 38 |
| 2013 Mayo | 12 | 28 | 40 |
| 2013 Abril | 15 | 18 | 33 |
| 2013 Marzo | 18 | 16 | 34 |
| 2013 Febrero | 23 | 6 | 29 |
| 2013 Enero | 24 | 8 | 32 |
| 2012 Diciembre | 17 | 11 | 28 |
| 2012 Noviembre | 0 | 1 | 1 |
Mostrar todo
